2.1. Reaction) C-terminal domain was amplified from vector pENTR211.

2.1. Amplification of BMP-2 C-terminal by PCR (Polymerase Chain
Reaction)

C-terminal domain was amplified
from vector pENTR211. The pENTR211 vector, which contains the mature BMP-2 gene
of human origin was purchased from Labome (USA). Specific primers were designed
for the amplification and cloning of C-terminal domain of BMP-2 into pAN5
vector: Forward 5′- CCCGCTCGAGGTTCAGACGTTGGTCAACTCTG
– 3′, Reverse 5′ – CCGCAAGCTTCTAGCGACACCCACAACCCTCC
– 3′. Also specific primers were designed for the amplification and cloning of
C-terminal domain of BMP-2 into pET29c vector (Novagen, USA) from pAN5
recombinant vector : Forward 5′ – CCGCCATATGTCCGGCCTGAACGACATCTTCG – 3′,
Reverse 5′ – CCGCGGATCCCTAGTGATGGTGATGGTGATGGCGACACCCAC AACCCTCC – 3′. Each
sequence was amplified with PCR using Taq DNA polymerase kit : DNA
template 10-20ng, Forward Primer 0.5 M, Reverse primer 0,5 M, Polymerase Buffer
1X, DNA polymerase 1U/L, dNTPS 200mM each, ddH2O up to 50?l. The conditions of each reaction
were: i) Initial denaturation at 94oC for 5min, 25 cycles of i)
denaturation at 94oC for 30s, ii) annealing at TM of each pair of
primer for 30s, iii) extension at 72oC for 30s, iv) final extension
at 72oC for 7 min and storage at 4oC.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now